View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9028_low_21 (Length: 246)
Name: NF9028_low_21
Description: NF9028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9028_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 226
Target Start/End: Original strand, 41960941 - 41961153
Alignment:
| Q |
14 |
attatactcaaagtctttacgtcaatgtggtaatcaaacgacgtgtctcattgatgttgggtaccaatggcatcccaactgattgaatcacatggttgaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41960941 |
attatactcaaagtctttacgtcaatgtggtaatcaaacaacgtgtctcattgatgttgggtaccaatggcatcccaactgattgaatcacatggttgaa |
41961040 |
T |
|
| Q |
114 |
aggaagaattggtgtgtcaagtgtgataacataggcctacattgaatgaaattgtgaggattctcaatgatatataggcccctttcataattcagtagct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41961041 |
aggaagaattggtgtgtcaagtgtgataacataggcctacattgaatgaaattgtgaggattctcaatgatatataggcccctttcataattcagtagct |
41961140 |
T |
|
| Q |
214 |
atggaaaacccaa |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41961141 |
atggaaaacccaa |
41961153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University