View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9029_low_19 (Length: 355)
Name: NF9029_low_19
Description: NF9029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9029_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 14 - 340
Target Start/End: Complemental strand, 24183316 - 24182990
Alignment:
| Q |
14 |
gacggggttttcgacattgcgttgtctgtttgggagccactccacatcaaggccgacgaggaagcggcggctgcggctagtttgggagagggttgaaagc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24183316 |
gacggggttttcgacattgcgttgtctgtttgggagccactccacatcaaggccgacaaggaagcggcggctgcggctagtttgggagagggttgaaagc |
24183217 |
T |
 |
| Q |
114 |
cagcaatcaaccatggaaggatcatgtgtgaccattgtgtgaatggtttcggagtggaagacaacattgtagttttcgtgagtggacattttggctttga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24183216 |
cagcaatcaaccatggaaggatcatgtgtgaccattgtgtgaatggtttcggagtggaagacaacattgtagttttcgtaagtggacattttggctttga |
24183117 |
T |
 |
| Q |
214 |
agagaaggttatttctgaaaaacgatttaataatgacactctttgtttttgtttaaagagtgtaataatacattgaaacggaagaacaattcctttatat |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24183116 |
agagaaggttatttctgaaaaacgatttaataatgacactctttgtttctgtttaaagagtgtaataatacattgaaacggaagaacaattcctttatat |
24183017 |
T |
 |
| Q |
314 |
agagtaagaatgaaaatagtagggagt |
340 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
24183016 |
agagtaagaatgaaaatagtagggagt |
24182990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University