View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9029_low_23 (Length: 255)
Name: NF9029_low_23
Description: NF9029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9029_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 5894860 - 5895102
Alignment:
| Q |
1 |
attatgtgattttttcaaattatttagttgtgtctgtgtcgtg------tccgtatataataactaatagggcagggctattaatataccactataccat |
94 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5894860 |
attatatgattttttcaaattatt-agttgtgtccgtgtcgtgtccgtgtccgtatataataactaatagggcagggctattaatataccactataccat |
5894958 |
T |
|
| Q |
95 |
atgttgatgattaaggttgggaacccagtcatttgtggcagggttgcttttatagcctctaaattgggtttcaccgtggcttgcaggtaactgaatccca |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5894959 |
atgttgatgattaaggttgggaacccagtcatttgtggcagggttgcttttataacctctaaattgggtttcaccgtggcttgcaggtaactgaatccca |
5895058 |
T |
|
| Q |
195 |
tattcaccttcatctccatctttaaccgcttttataaacccact |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5895059 |
tattcaccttcatctccatctttaaccgcttttataaacccact |
5895102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University