View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9029_low_24 (Length: 250)
Name: NF9029_low_24
Description: NF9029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9029_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 10 - 175
Target Start/End: Complemental strand, 1073280 - 1073114
Alignment:
| Q |
10 |
attatactaagtaattaaagttgtaatttatatccaaaccaagcatgtgggacaatttgcttcaaagcttaaactaatgctgttgttattacgtgtttgt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1073280 |
attatactaagtaattaaagttgtaatttatattcaaaccaagcatgtgggacaatttgcttcaaagcttaaactaatgctgttgttattacgtgtttgt |
1073181 |
T |
|
| Q |
110 |
ctatc-acatggatatagctcattttcatcttattattgattgattactggtaagtgtcggactttg |
175 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1073180 |
ctatcaacatggatatagctcgttttcatcttattattgattgattattggtaagtgtcggactttg |
1073114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 86
Target Start/End: Complemental strand, 10656571 - 10656539
Alignment:
| Q |
54 |
atgtgggacaatttgcttcaaagcttaaactaa |
86 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
10656571 |
atgtggggcaatttgcttcaaagcttaaactaa |
10656539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University