View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9029_low_30 (Length: 209)

Name: NF9029_low_30
Description: NF9029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9029_low_30
NF9029_low_30
[»] chr1 (1 HSPs)
chr1 (17-204)||(11584823-11585010)


Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 11585010 - 11584823
Alignment:
17 aaatttgcagcacatggttaaatcgaccatcatcaatcgaagactaaaaaattggcatttgctacctgatgtcggaagcttatcattactgaaatattaa 116  Q
    |||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
11585010 aaatttgcagcagatggttaaaccgaccatcatcaatcgaagactaaaaaattggcattcgctacctgatgtcggaagcttatcattactgaaatattaa 11584911  T
117 aagaaatgttcttagaaactttattaccaaaatcagtgtatctctttctaggtgcatgaagaaactcggcataatcttgatgtccatc 204  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
11584910 aagaaatgttctgagaaactttattaccaaaatcagtgtatctctttctaggtgcatgaagaaactcggcataatcttgttgtccatc 11584823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University