View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9031_high_8 (Length: 335)
Name: NF9031_high_8
Description: NF9031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9031_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 236 - 325
Target Start/End: Original strand, 34647382 - 34647471
Alignment:
| Q |
236 |
cgatggctacaattaagaggccctgtgtgactcgattgacacgagcataaccaacacaagtagtaacaaccggcaacaggacagtataat |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34647382 |
cgatggctacaattaagaggccctgtgtgactcgattgacacgagcataaccaacacaagtagtaacaaccggcaacaggacaatataat |
34647471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University