View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9031_low_18 (Length: 422)
Name: NF9031_low_18
Description: NF9031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9031_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 280; Significance: 1e-156; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 18 - 305
Target Start/End: Original strand, 12322537 - 12322823
Alignment:
| Q |
18 |
gttctgaggtgacaaaagtgtttgtgattataagctataacacgtgacatgttattagtggttcattgttacgtatagtatggtcatagtttcaattctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12322537 |
gttctgaggtgacaaaagtgtttgtgattataagctataacacgtgacatgttattagtggttcattgttacgtatagtatggtcatagtttcaattctt |
12322636 |
T |
 |
| Q |
118 |
aggcaatattttcacatgcagctataagaagattctgcagaaatttcaagaactaagaaagaaagtcttcattttcagtttgtggtcacattactttatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12322637 |
aggcaatattttcacatgcagctataagaagattctgcagaaatttcaagaactaagaaagaaagtcttcattttcagtttgtggtcacattactttatt |
12322736 |
T |
 |
| Q |
218 |
tttcatgagaggagatgaagagacacgtgttgatgagaatatttcacgggatgggtgtttttattttgtgtgtgtcacggacgaatgg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12322737 |
tttcatgagaggagatgaagagacacgtgttgatgagaatatttcacgggat-ggtgtttttattttgtgtgtgtcacggacgaatgg |
12322823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University