View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9031_low_24 (Length: 326)
Name: NF9031_low_24
Description: NF9031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9031_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 17 - 314
Target Start/End: Original strand, 52987859 - 52988156
Alignment:
| Q |
17 |
aactaccagcccctgaatgtccatgcctgccacagcattccttcatgtagctcttgcaacatccaccaacttctctcttgtcaaaactaatgcaagcatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987859 |
aactaccagcccctgaatgtccatgcctgccacagcattccttcatgtagctcttgcaacatccaccaacttctctcttgtcaaaactaatgcaagcatg |
52987958 |
T |
 |
| Q |
117 |
cataattgacgattcgatcgattcctttgaatagccctcattcttgcaacatggactaacttccctctcatttggaccctcacagccaccacacacaaca |
216 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987959 |
cataattgacgattctatcgattcctttgaatagccctcattcttgcaacatggactaacttccctctcatttggaccctcacagccaccacacacaaca |
52988058 |
T |
 |
| Q |
217 |
ggcaatttggggcagtctgtacaagaatctttttctttctctgccagacttgaacaaccatgcatcgaggctaattcaacgtgctcggttatgatgtc |
314 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52988059 |
ggcaatttggggcagtctttacaagaatctttttctttctctgccagatttgaacaaccatgcatcgaggctaattcaacgtgctcggttatgatgtc |
52988156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University