View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9031_low_27 (Length: 305)
Name: NF9031_low_27
Description: NF9031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9031_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 72 - 289
Target Start/End: Original strand, 29997793 - 29998012
Alignment:
| Q |
72 |
caaagatagagggaggagatcgccacgcaaagacaaaggtaggatataaatctcacccatcagcacaatttttaaatctcacacggaggatttctttagt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29997793 |
caaagatagagggaggagatcgccacgcaaagacaaaggtaggagataaatctcacccatcagcacaatttttaaatctcacacggaggatttctttagt |
29997892 |
T |
|
| Q |
172 |
ttgggattttcactatacattgtatctatcannnnnnnnnctt---ccaatgatttaaggacctccatcacttgcttgaatatgtctcttgttatcttac |
268 |
Q |
| |
|
||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
29997893 |
ttgggattttcactatacattgtatgtatctatcattttttttttcccaatgatttaaggacctccatcactagcttgaatatgtctcttgttatc-tac |
29997991 |
T |
|
| Q |
269 |
atattaaataaagcattctta |
289 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29997992 |
atattaaataaagcattctta |
29998012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University