View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9031_low_29 (Length: 265)

Name: NF9031_low_29
Description: NF9031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9031_low_29
NF9031_low_29
[»] chr3 (1 HSPs)
chr3 (1-39)||(52134690-52134728)


Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 52134690 - 52134728
Alignment:
1 catttccaacccaggaactccaaatttggtggtttatag 39  Q
    ||||||||| |||||||||||||||||||||||||||||    
52134690 catttccaatccaggaactccaaatttggtggtttatag 52134728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University