View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9032_high_5 (Length: 400)
Name: NF9032_high_5
Description: NF9032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9032_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 19 - 360
Target Start/End: Complemental strand, 29193671 - 29193335
Alignment:
| Q |
19 |
acatcattacactattacaatttatcacatctaacagtgttagaagcaacttgtatatatgtgcgttacacttacctgtttctgccggcgacgatgatcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29193671 |
acatcattacactattacaatttatcacatctaacagtgttagaagcaacttgtatatatgtgcgttaaacttacctgtttctgccggcgacgatgatcc |
29193572 |
T |
 |
| Q |
119 |
gaaggtcagggcagaagttggacagtgcggtggcggttgatcctccgacacgacctgttccgccgagaaccaacacttttgagttgcggattttgtccgg |
218 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29193571 |
gaaggtcagggcagaagttggagagtgcggtggcggttgatcctccgacacgacctgttccgccgagaaccaacacttttgagttgcggattttgtccgg |
29193472 |
T |
 |
| Q |
219 |
tagctcagggaggttggtggcggaggcggttaccttgaaattcaaattgagaggtaatgaaattggcgccattgattggtttggtttgatgagattggtt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
29193471 |
tagctcagggaggttggtggcggaggcggttaccttgaaattcaaattgagaggtaatgaagttggcgccattgattgg-----tttgatgagattggtt |
29193377 |
T |
 |
| Q |
319 |
agtttctcttcatttctcagtgttgcactttgtcttatcgcc |
360 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29193376 |
agtttctcttcatttgtcagtgttgcactttgtcttatcgcc |
29193335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University