View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9032_high_7 (Length: 373)
Name: NF9032_high_7
Description: NF9032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9032_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 13 - 360
Target Start/End: Original strand, 26031523 - 26031869
Alignment:
| Q |
13 |
gcagagagggacaagtgtcattcccaaatcaaccaacccaaataggatcaaagagaatgtggttgtcttcaattgggaacttccagataatgacttcaac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26031523 |
gcagagagggacaagtgtcattcccaaatcaaccaacccaaataggatcaaagagaatgtggttgtcttcaattgggaacttccagataatgacttcaac |
26031622 |
T |
|
| Q |
113 |
aaacttagcaaaataccagatcaggtagctcacaagcatgggtcgaaatagtttccgatttgataaatagatctttaaaattgttaatttcatccaaaat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26031623 |
aaacttagcaaaataccagatcaggtagctcacaagcattggtcgaaatag-ttccgatttgataaatagatctttaaaattgttaatttcatccaaaat |
26031721 |
T |
|
| Q |
213 |
ggtccatccgttgacttctactattggagctatgatgtggcacgttaacgggatatactacattgcatgttgatctcacattaaggtcatccaactagtg |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| || ||||| |||| |||||||||||||| ||| ||| || | ||||||| | ||||| |
|
|
| T |
26031722 |
ggtccatccgttgacttctactattggagctatgacgtggaacattaaccaaatatgctacattgcatgttcatcccacgttgacgtcatcccattagtg |
26031821 |
T |
|
| Q |
313 |
cctatgaaattcaggtcttcttaaggataaatttgtcggtaattattg |
360 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||| |||||||||| |
|
|
| T |
26031822 |
cctatgaaattcaggtcttcttggggacaaatttgtcagtaattattg |
26031869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University