View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9032_low_22 (Length: 240)
Name: NF9032_low_22
Description: NF9032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9032_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 112 - 223
Target Start/End: Complemental strand, 38108058 - 38107947
Alignment:
| Q |
112 |
tcaatttaagtgaatggcggtccaactcaatttttcaatttggaaaggggttgtgctaaggtgaccctctttcatcttttttattctttattgcagttga |
211 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38108058 |
tcaatttaagtgaatggcagtccaactcaattattcaatttggaaaggggttgcgctaaggtgaccctctttcatcttttttattctttattgcagttga |
38107959 |
T |
|
| Q |
212 |
aggtctgaatgt |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38107958 |
aggtctgaatgt |
38107947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University