View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9032_low_7 (Length: 481)
Name: NF9032_low_7
Description: NF9032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9032_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 268
Target Start/End: Original strand, 4097904 - 4098152
Alignment:
| Q |
19 |
cactgttattgttggtggtttgtatgccttttgtaacatgcaactgaaaatcatgttctgggattgtgatgtgtgctatgaacatgtttcttttaacann |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4097904 |
cactgttattgttggtggtttgtatgccttttgtaacatgcaactgaaaatcatgttctgggattgtgatgtgtgctatgaacatgttt-ttttaacatt |
4098002 |
T |
|
| Q |
119 |
nnnnnagccttcaatattttattggataaaattaaccgtatctttcatatttttaaaatgaatttcatataaaatagtgagatcaacataaattgcattc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4098003 |
tttttagccttcaatattttattggataaaattaaccgtatctttcatatttttaaaatgaatttcatataaaatagtgagatcaacataaattgcattc |
4098102 |
T |
|
| Q |
219 |
aataaaatgttaaaagttaaaaacagagtgttttgattactactattact |
268 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
4098103 |
aataaaatgataaatgttaaaaacagagtgttttggttactactattact |
4098152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University