View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9033_low_10 (Length: 284)
Name: NF9033_low_10
Description: NF9033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9033_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 19 - 164
Target Start/End: Complemental strand, 34362691 - 34362542
Alignment:
| Q |
19 |
caacgtaatttctttgagtcatttcccctactttctttgacacggaagaacaaatggataac--tctaattgaattttaataaatcaaagaac--atata |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| | ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
34362691 |
caacgtaatttctttgagtcatttcccctactttctttgacacagaagaacaaatgaatacctgtctaaatgaattttaataaatcaaagaacatatata |
34362592 |
T |
 |
| Q |
115 |
ttgtaactgcacgatcaaagatgtgggtgaggatttttttggtggttaaa |
164 |
Q |
| |
|
|| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34362591 |
ttttaactgcacgatcaaacatgtgggtgaggatttttttggtggttaaa |
34362542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University