View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9033_low_8 (Length: 294)
Name: NF9033_low_8
Description: NF9033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9033_low_8 |
 | |
|
| [»] scaffold0115 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 16 - 270
Target Start/End: Original strand, 2531041 - 2531295
Alignment:
| Q |
16 |
ttggtgttatgttgcagaattttgcagttcagttttgtcttatcagtacgactgtgattagtttatgatgttggaagagctgctgtgatgctgcaaaatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2531041 |
ttggtgttatgttgcagaattttgcagttcagttttgtcttatcagtactactgtgattagtttatgatgttggaagagctgctgtgatgctgcaaaatt |
2531140 |
T |
|
| Q |
116 |
ttggggttctagtttggtgtatcagtttgtgttctttagcgttgatgatgctttggagttttagcttcgttccagccatgcgtcctaaggtgtcaagcaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2531141 |
ttggggttctagtttggtgtatcagtttgtgttctttagcgttgatgatgctttggagttttagcttcgttccagccatgcgtcctaaggtgtcaagcaa |
2531240 |
T |
|
| Q |
216 |
gtgagcttcaggttaagtttgatgatgttgtagagttattagactcattccagcc |
270 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2531241 |
gtgagcttcaggttaagcttgatgatgttgtagagttattagactcattccagcc |
2531295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 176 - 232
Target Start/End: Original strand, 24613389 - 24613445
Alignment:
| Q |
176 |
ttagcttcgttccagccatgcgtcctaaggtgtcaagcaagtgagcttcaggttaag |
232 |
Q |
| |
|
||||| ||||||||||| || |||||||||| |||| |||||||||||||||||| |
|
|
| T |
24613389 |
ttagcctcgttccagccctgtgtcctaaggtactaagcgagtgagcttcaggttaag |
24613445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0115 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: scaffold0115
Description:
Target: scaffold0115; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 271
Target Start/End: Complemental strand, 38922 - 38669
Alignment:
| Q |
16 |
ttggtgttatgttgcagaattttgcagttcagttttgtcttatcagtacgactgtgattagtttatgatgttggaagagctgctgtgatgctgcaaaatt |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||| ||||||||||| ||||||||||||||||||||||||| ||| || ||||||||||||||||| |
|
|
| T |
38922 |
ttggtgttatgttgcagaatgttgcagttc--ttttggcttatcagtactactgtgattagtttatgatgttggaggagttgatgtgatgctgcaaaatt |
38825 |
T |
|
| Q |
116 |
ttggggttctagtttggtgtatcagtttgtgttctttagcgttgatgatgctttggagttttagcttcgttccagccatgcgtcctaaggtgtcaagcaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
38824 |
ttggggttctagtttggtgtatcagtttgtgttctttagctttgatgatgcttcggaattttagcttcgttctagccatgtgtcctaaggtgtcaagcaa |
38725 |
T |
|
| Q |
216 |
gtgagcttcaggttaagtttgatgatgttgtagagttattagactcattccagcct |
271 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38724 |
gtgagcttcaggttaagcttgatgatgttgcagagttattagactcattccagcct |
38669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 16 - 76
Target Start/End: Original strand, 9470264 - 9470324
Alignment:
| Q |
16 |
ttggtgttatgttgcagaattttgcagttcagttttgtcttatcagtacgactgtgattag |
76 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||||||| |||| |||||| |
|
|
| T |
9470264 |
ttggtgttatgttgcagaattttgcagtttagttttggcttatcagtactactgcgattag |
9470324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 98 - 126
Target Start/End: Complemental strand, 31003323 - 31003295
Alignment:
| Q |
98 |
ctgtgatgctgcaaaattttggggttcta |
126 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31003323 |
ctgtgatgctgcaaaattttggggttcta |
31003295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University