View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9035_high_4 (Length: 275)
Name: NF9035_high_4
Description: NF9035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9035_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 11 - 257
Target Start/End: Complemental strand, 9966980 - 9966737
Alignment:
| Q |
11 |
gattattctacttttcctgaaggtggatcagacgatggtgccggtggattttccggcacaggtgccgatggtcgaggaggaatttcttcatcaacatagt |
110 |
Q |
| |
|
|||| |||||||||| | |||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9966980 |
gattcttctacttttacggaaggtggctcagacgatggtgtcggtggattttccggcacaggtgccgatggtcgaggaggaatttcttcatcaacatagt |
9966881 |
T |
 |
| Q |
111 |
aaattttcaagccaacttttccttgaaccatattgaacaaacttttcttcttcaactcataataaatcaaagcttcttcaccttttttcacaaactgggt |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9966880 |
aaattttcaagccaacttttcctcgaaccatattgaacaaacttttcttcttcaactcataataaatcaaagcttcttcaccttttttcacaaactgggt |
9966781 |
T |
 |
| Q |
211 |
cgagctaagtcgaacttgacccagcagagagttttctctccgggttg |
257 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9966780 |
cgagctaagtcgaacttgacccagc---gagttttctctccgggttg |
9966737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 11 - 257
Target Start/End: Complemental strand, 9936814 - 9936568
Alignment:
| Q |
11 |
gattattctacttttcctgaaggtggatcagacgatggtgccggtggattttccggcacaggtgccgatggtcgaggagga---atttcttcatcaacat |
107 |
Q |
| |
|
|||| |||||||||||| || ||||| |||||||||||||||||||||||||||||||||||| ||| |||| |||||||| |||||||||||||||| |
|
|
| T |
9936814 |
gattcttctacttttccggatggtggctcagacgatggtgccggtggattttccggcacaggtaccggtggtggaggaggaggaatttcttcatcaacat |
9936715 |
T |
 |
| Q |
108 |
agtaaattttcaagccaacttttccttgaaccatattgaacaaacttttcttcttcaactcataataaatcaaagcttcttcaccttttttcacaaactg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9936714 |
agtaaattttcaagccaacttttccttgaaccatattgaacaaacttttcttcttcaactcataataaatcaaagcttcttcaccttttttcacaaactg |
9936615 |
T |
 |
| Q |
208 |
ggtcgagctaagtcgaacttgacccagcagagagttttctctccgggttg |
257 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
9936614 |
tgtcgagctaagtcgaacttgacc---cagtgagttttctctccgggttg |
9936568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University