View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9035_low_18 (Length: 218)
Name: NF9035_low_18
Description: NF9035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9035_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 35952662 - 35952859
Alignment:
| Q |
1 |
attattagcagtgtcggcgtgtccgtatccggtgtccgtgtccactaacagaagatgtaaactgaactaacattaaaaatacattttctgtctgtgactg |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||| | | |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35952662 |
attattagcagtggcggcgtgtccgtatccaatgtccat------tgacagaagatgtaaactgaactaacattaaaaatacattttctgtttgtgactg |
35952755 |
T |
 |
| Q |
101 |
acatagccattgtcttttcatttagaaactgatgtccaaagcagtttttgcagatgcagtggtagctgtaaaacgagcaattttgttttcgtgttttgct |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35952756 |
acatagcctttgtcttttcatttagaaactgatgtccaaagcagtttttgcagatgcagtggtagctgtaaaacgagcaattttgttttcgtgttttgct |
35952855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 31236622 - 31236651
Alignment:
| Q |
1 |
attattagcagtgtcggcgtgtccgtatcc |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31236622 |
attattagcagtgtcggcgtgtccgtatcc |
31236651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University