View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9036_low_29 (Length: 343)
Name: NF9036_low_29
Description: NF9036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9036_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 303
Target Start/End: Original strand, 44884388 - 44884690
Alignment:
| Q |
1 |
gtcaaggtcttcattgggaagatggtacttgagagtgaaaggtcttcttccatgaaggagagtgcgagagaggtgagaaaagaggtgtgataaggaagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44884388 |
gtcaaggtcttcattgggaagatggtacttgagagtgaaaggtcttcttccatgaaggagagtgcgagagaggtgagaaaagaggtgtgataaggaagag |
44884487 |
T |
|
| Q |
101 |
tgacggtcaacggcgacgatacgagtgtcgccaccaacgtagtagagggagttgtcacgtggcatgatgtggccaccgtagctgcacatgaggcggagtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44884488 |
tgacggtcaacggcgacgatacgagtgtcgccaccgacgtagtagagggagttgtcacgtggcatgatgtggccgccgtagctgcacatgaggcggagtt |
44884587 |
T |
|
| Q |
201 |
tggagccaggcacgtgagggatgaggaggagatcagatgtgtcattatgataatgatgacgaggagaggaaggcagtgctggcaccgaatcagggaaagg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
44884588 |
tggagccaggcacgtgagggatgaggaggagatcagatgtgtcattatgataatgatgacgaggagaggaaggcagtgctgacaccgattcagggaaagg |
44884687 |
T |
|
| Q |
301 |
gag |
303 |
Q |
| |
|
||| |
|
|
| T |
44884688 |
gag |
44884690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 47
Target Start/End: Complemental strand, 30769913 - 30769868
Alignment:
| Q |
2 |
tcaaggtcttcattgggaagatggtacttgagagtgaaaggtcttc |
47 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| || ||||||| |
|
|
| T |
30769913 |
tcaaggtcttcatttggaagctggtacttgagagtaaagggtcttc |
30769868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University