View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9036_low_35 (Length: 239)
Name: NF9036_low_35
Description: NF9036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9036_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 2 - 223
Target Start/End: Original strand, 16730320 - 16730541
Alignment:
| Q |
2 |
tggtgttgaattaagatcttgaagtgtggtttcagattccattctctgatgtcaatttggatggattaatttcgttttttaagtatttttattcgttgca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16730320 |
tggtgttgaattaagatcttgaagtgtggtttcagattccattctctgatgtcaatttggattgattaatttcgttttttaagtatttttattcgttgca |
16730419 |
T |
 |
| Q |
102 |
aagagggttagttgtattgtgaatgaaagttaattaaagacgagattattgcaaagagatttatgtatcaaaatgggacaattttatgagattttgtcat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16730420 |
aagagggttagttgtattgtgaatgaaagttaattaaagatgagattattgcaaagagatttatgtatcaaaatgggacaattttatgagattttgtcat |
16730519 |
T |
 |
| Q |
202 |
ggtgatagtgtgtttgattttt |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
16730520 |
ggtgatagtgtgtttgattttt |
16730541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University