View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9036_low_37 (Length: 237)
Name: NF9036_low_37
Description: NF9036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9036_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 7948329 - 7948529
Alignment:
| Q |
19 |
gagactgttaaccaaggcagagaaagcaggtttattatcggcagccgagaaagcaggattatctctctcaacaatagagaaacttggtctcctttcaaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7948329 |
gagactgttaaccaaggcagagaaagcaggtttattatcggcagccgagaaagcaggattatctctctcaacaatagagaaacttggtctcctttcaaaa |
7948428 |
T |
|
| Q |
119 |
gcagaagaacttggtgtcttatcagctgctactgatccatcaactccaggatcactcttcacactcagctttgttttgcttcttttaggtcctttgtttg |
218 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7948429 |
gcagaagaacttggtgttttatcagctgctactgatccatcaactccaggatcactcttcacactcagctttgttttgcttcttttaggtcctttgtttg |
7948528 |
T |
|
| Q |
219 |
t |
219 |
Q |
| |
|
| |
|
|
| T |
7948529 |
t |
7948529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University