View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9036_low_42 (Length: 216)
Name: NF9036_low_42
Description: NF9036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9036_low_42 |
 | |
|
| [»] scaffold0697 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 11 - 197
Target Start/End: Complemental strand, 33320517 - 33320333
Alignment:
| Q |
11 |
gattatactttaaatttatttattgtattggatgtgttactagggcaacttttgatttattttcgaagaggtgattttggtggtcttttatgttaaatct |
110 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||| | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33320517 |
gattatactttaaattta---attttattggatgtgttactggtgcaacttttgatttatttttgaagaggtgattttggtggtcttttatgttaaatct |
33320421 |
T |
|
| Q |
111 |
ttacagtcgaagaaataaatagttggaaactatatatatgattccga-tgctagtgttgttgcctttattattagaaggagagctact |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | || | ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33320420 |
ttacagtcgaagaaataaatagttggaaactatatatatatatatgattcctagtgttgttgcctttatcattggaaggagagctact |
33320333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0697 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: scaffold0697
Description:
Target: scaffold0697; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 11 - 96
Target Start/End: Complemental strand, 3587 - 3502
Alignment:
| Q |
11 |
gattatactttaaatttatttattgtattggatgtgttactagggcaacttttgatttattttcgaagaggtgattttggtggtct |
96 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| ||||||||| ||||||||||||||||||| ||| | ||||||||| |||||| |
|
|
| T |
3587 |
gattatactttaaatttatttactctattggatatgttactagtgcaacttttgatttatttttgaaaaagtgattttgctggtct |
3502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 3e-22; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 11 - 96
Target Start/End: Complemental strand, 21532629 - 21532544
Alignment:
| Q |
11 |
gattatactttaaatttatttattgtattggatgtgttactagggcaacttttgatttattttcgaagaggtgattttggtggtct |
96 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| ||||||||| ||||||||||||||||||| ||| | ||||||||| |||||| |
|
|
| T |
21532629 |
gattatactttaaatttatttactctattggatatgttactagtgcaacttttgatttatttttgaaaaagtgattttgctggtct |
21532544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 11 - 73
Target Start/End: Original strand, 22905436 - 22905498
Alignment:
| Q |
11 |
gattatactttaaatttatttattgtattggatgtgttactagggcaacttttgatttatttt |
73 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
22905436 |
gattatactttaaatttatttactatattggatatgttactagtgcaacttttgatttatttt |
22905498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 11 - 96
Target Start/End: Original strand, 10641367 - 10641452
Alignment:
| Q |
11 |
gattatactttaaatttatttattgtattggatgtgttactagggcaacttttgatttattttcgaagaggtgattttggtggtct |
96 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| |||||| || ||||||||||||||||||| ||| | ||||||||| |||||| |
|
|
| T |
10641367 |
gattatactttaaatttatttactctattggatatgttacaagtgcaacttttgatttatttttgaaaaagtgattttgttggtct |
10641452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 11 - 96
Target Start/End: Complemental strand, 32714240 - 32714155
Alignment:
| Q |
11 |
gattatactttaaatttatttattgtattggatgtgttactagggcaacttttgatttattttcgaagaggtgattttggtggtct |
96 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| |||||| || ||||||||||||||||||| ||| | ||||||||| |||||| |
|
|
| T |
32714240 |
gattatactttaaatttatttactctattggatatgttacaagtgcaacttttgatttatttttgaaaaagtgattttgttggtct |
32714155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 11 - 89
Target Start/End: Original strand, 26665168 - 26665246
Alignment:
| Q |
11 |
gattatactttaaatttatttattgtattggatgtgttactagggcaacttttgatttattttcgaagaggtgattttg |
89 |
Q |
| |
|
|||||||||| ||||||||||| | |||||||| ||||||||| ||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
26665168 |
gattatacttaaaatttatttactctattggatatgttactagtgcaacttttgatttatttttgaaaaagtgattttg |
26665246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University