View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9039_low_6 (Length: 210)
Name: NF9039_low_6
Description: NF9039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9039_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 26828005 - 26827819
Alignment:
| Q |
18 |
gtaagtaattccctaaattctaggaagtgttaattatgctattgtttattagcttagtgtgatctatcattgacatagtgtaaatacttgcaaggatgca |
117 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26828005 |
gtaagtaattccataaattctaggaagtgttaattatgctattgtttattagcttagtgtgatttatcattgaaatagtgtaaatacttgcaaggatgca |
26827906 |
T |
|
| Q |
118 |
acttcacattgagtgag--aacaataaagttttctgagattttatttatcattcattttctttgatatctttcaatctctgcttctc |
202 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || ||||| |
|
|
| T |
26827905 |
acttcacattgagtgagaaaacaataaagttttctgagattttatttatcattcattttctttgatatctttcgatctttgattctc |
26827819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University