View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9040_high_11 (Length: 446)
Name: NF9040_high_11
Description: NF9040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9040_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 70 - 430
Target Start/End: Complemental strand, 51000528 - 51000168
Alignment:
| Q |
70 |
atgcagatgacatgatgctacattggaaccagaattctggttaatcttagtaatatcaagcacaattgtgttgattttctgtgctatctttcttttaagc |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51000528 |
atgcagatgacatgatgctacattggaaccagaattctggttaatcttagtaatatcaagcacaattgtgttgattttctgtgctatctttcttttaagc |
51000429 |
T |
 |
| Q |
170 |
atggttcctatgagctgcgcattaaatggattgtgagcaatcacgagtacttgttttgcatattttgtggttccatctatgggtcaaccataatagatgg |
269 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51000428 |
atgtttcctatgagctgcgcattaaatggattgtgagcaatcacgagtacttgttttgcatattttgtggttccatctatgggtcaaccataatagatgg |
51000329 |
T |
 |
| Q |
270 |
atcccccaagcatattgtggttcttcaaatatgcttgttttgcatattttaaatggttttatataatgcttcacactttacagggccgcaaatctggcat |
369 |
Q |
| |
|
||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51000328 |
atctcccaaccatattgtggttcttcaaatatgcttgttttgcatattttaaatggttttatataatgcttcacactttacagggccgcaagtctggcat |
51000229 |
T |
 |
| Q |
370 |
attctcacatttgcatgtagttccggtaaccctgggtgatagcagctctcatagtagttca |
430 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
51000228 |
attctcacatttgcatgtagttccggtaaccctgggtggtagcagctctcatagtggttca |
51000168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University