View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9040_high_16 (Length: 303)
Name: NF9040_high_16
Description: NF9040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9040_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 17 - 299
Target Start/End: Original strand, 30296654 - 30296935
Alignment:
| Q |
17 |
gtgacatattccgccttgcaagacaattcgattttttcaggatgctatcttgttatttcactacaattggattttacttcagcagcttggtaatttcact |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30296654 |
gtgacatattccgccttgcaagacaattcgatttttttaggatgctatcttgttatttcactactattggattttacttcagcagcttggtaatttcact |
30296753 |
T |
 |
| Q |
117 |
gaaccataatattcttctctatgatata-ttcactatcctgttgcctatatgaagagaagtatgacatgtatagattctttacataatgcaattttgact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30296754 |
gaaccataatattcttctctatgatatatttcactatcctgttgcctatatgaagagaagtatgacatgtatagattctt--cataatgcaattttgact |
30296851 |
T |
 |
| Q |
216 |
gatataaatctattgcatttcttcacagatatcagtaataggaatatatgtatttctctacggacagttataccttgttcttag |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30296852 |
gatataaatctattgcatttcttcacagatatcagtaataggaatatatgtatttctctacggacagttataccttgttcttag |
30296935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 42 - 100
Target Start/End: Original strand, 52617563 - 52617621
Alignment:
| Q |
42 |
attcgattttttcaggatgctatcttgttatttcactacaattggattttacttcagca |
100 |
Q |
| |
|
|||||| || ||||| ||||| |||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
52617563 |
attcgacttcttcagaatgctgtcttgttatttcacaacaattgggttttacttcagca |
52617621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University