View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9040_high_18 (Length: 298)
Name: NF9040_high_18
Description: NF9040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9040_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 229267 - 228987
Alignment:
| Q |
1 |
cagatcctttaatgaggaaatgggccaagaataaacagttatactatgtatcaacattccttgaatcactgactttactagctgaattctaccataaatg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229267 |
cagatcctttaatgaagaaatgggccaagaataaacagttatactatgtatcaacattccttgaatcactgactttactagctgaattctaccataaatg |
229168 |
T |
|
| Q |
101 |
gatagtaatgaggctttccaagcactaagctttagtttgatcttgtctgctaaaggttggaaatacaatgatttaggtttccctttgaaaatgggaactc |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
229167 |
gacagtaatgaggctttccaagcactaagctttagtttgatcttgtctgctaaaggttggaaatgcaatgatttaggtttccctttgaaaatgggaactc |
229068 |
T |
|
| Q |
201 |
ctaaataagagaatggtaactggccaatgctgaagccaattaactatgcaagatgatgtaatctagatggtggaatggaac |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229067 |
ctaaataagagaatggtaactggccaatgctgaagccaattaactatgcaagatgatgtaatctagatggtggaatggaac |
228987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 198
Target Start/End: Complemental strand, 43580381 - 43580323
Alignment:
| Q |
140 |
atcttgtctgctaaaggttggaaatacaatgatttaggtttccctttgaaaatgggaac |
198 |
Q |
| |
|
|||||||| |||| ||| | |||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
43580381 |
atcttgtcagctatgggtagaaaatacaaagctttaggtttccctttgaaaatgggaac |
43580323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 172 - 209
Target Start/End: Original strand, 50560805 - 50560842
Alignment:
| Q |
172 |
tttaggtttccctttgaaaatgggaactcctaaataag |
209 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
50560805 |
tttaggtttccctttgaaaatagaaactcctaaataag |
50560842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University