View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9040_high_19 (Length: 294)
Name: NF9040_high_19
Description: NF9040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9040_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 30296954 - 30297230
Alignment:
| Q |
1 |
tatcattgaagcaagaatcaagaatgtacagtccttagaaacagctcttgcttctcaatcattcatacaacttggacttctaacaggcttaccgatgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30296954 |
tatcattgaagcaagaatcaagaatgtacagtccttagaaacagctcttgcttctcaatcattcatacaacttggacttctaacaggcttaccgatgatg |
30297053 |
T |
 |
| Q |
101 |
atggaaataggcctcgagagaggtttcctaacagccctcaaagattttatcctcatgcagttacagcttgcagctgttttcttcacattctcccttggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30297054 |
atggaaataggcctcgagagaggtttcctaacagccctcaaagattttatcctcatgcagttacagcttgcagctgttttcttcacattctcccttggaa |
30297153 |
T |
 |
| Q |
201 |
caaaaacacattactatggcagaacaattttgcacggaggcgcgaaatacagaccaaccggacgcaaagttgtcttc |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30297154 |
caaaaacacattactatggcagaacaattttgcacggaggcgcgaaatacagaccaaccggacgcaaagttgtcttc |
30297230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University