View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9040_high_20 (Length: 279)
Name: NF9040_high_20
Description: NF9040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9040_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 263
Target Start/End: Complemental strand, 46341723 - 46341478
Alignment:
| Q |
18 |
tttggaagggggaatggagttgtgccaaattaatttatcctaactaacattctgaccaccagggcagtgagatgtgtaagcttctttaaaagatagggtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
46341723 |
tttggaagggggaatggagttgtgccaaattaatttagcccaactaacattctgacccccagggcagtgaaatgtgtaagcttctttaaaagagagggtg |
46341624 |
T |
 |
| Q |
118 |
ccatcgtgagaatgtttccaagagatactgtcatcagtctgaataatgggaatgactgtgttagcaattaattggctaagtgcaagataggcttgtagga |
217 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46341623 |
ccatcatgagaatgtttccaagagatgctgtcatcagtctgaataatgggaatgactgtgttagcaattaattggctaagtgcaagataggcttgtagga |
46341524 |
T |
 |
| Q |
218 |
tgcaagttgagatatttcagcaaaagttgtaaatgtaactgtttag |
263 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46341523 |
tgcaagttgagatatttcagcaagagttgtaaatgtaactgtttag |
46341478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University