View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9040_high_24 (Length: 252)
Name: NF9040_high_24
Description: NF9040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9040_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 3 - 234
Target Start/End: Complemental strand, 3755085 - 3754854
Alignment:
| Q |
3 |
aagggggtaagaatttaaacaagtttatcaattgggcaaaggaataggaatattcaaacttgtggtcttgtttttacttccaatttcacgaaatagtcta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3755085 |
aagggggtaagaatttaaacaagtttatcaattgggcaaaggaataggaatattcaaacttgtggtcttgtttttacttccaatttcacgaaatagtcta |
3754986 |
T |
 |
| Q |
103 |
aatggtagataacatattgagttttaatcgctacttagtcagacatggtccgtcatggatcatttgtctcacttgttcaccgaaatactcgtctgtttat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3754985 |
aatggtagataacatattgagttttaatcgctacttagtcagacatggtccgtcatggatcatttgtttcacttgttcaccgaaatactcgtctgtttat |
3754886 |
T |
 |
| Q |
203 |
tcgtattttttatttacatagattgtcggcca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3754885 |
tcgtattttttatttacatagattgtcggcca |
3754854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University