View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9040_high_26 (Length: 234)
Name: NF9040_high_26
Description: NF9040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9040_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 217
Target Start/End: Original strand, 9731772 - 9731980
Alignment:
| Q |
9 |
tgtatataattttttcatgatcaatgtggtttatagacatacttttcgcaggttgtggagggaccaagagtataaggcaagtgaaccccacatttgctag |
108 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9731772 |
tgtatataattttttcatgatcaatggggtttatagacatacttttcgcaggttgtggagggaccaagagtataaggcaagtgaaccccacatttgctag |
9731871 |
T |
|
| Q |
109 |
ggaggccagcaaggatgtccatgttcagtccttggatcgcggaagtggcggtcttgatacacctacaggcagcttgacgatcagatttggtcacggcttg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9731872 |
ggaggccagcaaggatgtccatgttcagtccatggatcgcggaagtggcggtcttgatacacctacaggcagcttgacgatcggatttggtcacggcttg |
9731971 |
T |
|
| Q |
209 |
gttgtttat |
217 |
Q |
| |
|
||||||||| |
|
|
| T |
9731972 |
gttgtttat |
9731980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University