View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9040_low_31 (Length: 431)
Name: NF9040_low_31
Description: NF9040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9040_low_31 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 50 - 431
Target Start/End: Complemental strand, 36282070 - 36281689
Alignment:
| Q |
50 |
attgttggagaacaaagcagttttggactttgatgtattgtgttcttctgtggctttgaaagcttctcaagggaaatgggggaagctaggatccatggaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36282070 |
attgttggagaacaaagcagttttggactttgatgtattgtgttcttctgtggctttgaaagcttctcaagggaaatgggggaagctaggatccatggaa |
36281971 |
T |
|
| Q |
150 |
gaagaagaggaagaaagtggggtttttggtggggttttgaggatgtgggaaggtgaactttttgattgctttgatcatcgtcgcattgctctagaatcca |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36281970 |
gaagaagaggaagaaagtggggtttttggtggggttttgaggatgtgggaaggtgaactttttgattgcttcgatcatcgtcgcattgctctagaatcca |
36281871 |
T |
|
| Q |
250 |
taatgtaagcaatttacattcatattttatacgttaagtgcatgtttgagattgcagtgagatcgtaaaaattatggtggtcaccacgattttaacaaaa |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
36281870 |
taatgtaagcaatttacattcatattttatacgttaagtgcatgtttgagattgcggtgagatcgtaaaaattctggtggccaccacgattttaacaaaa |
36281771 |
T |
|
| Q |
350 |
actgcattttaaaacttcaaaaatcacggtgttgccgtaattttattaacgcgtttattcaaacatgcactgactctttctt |
431 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36281770 |
actacattttaaaacttcaaaaatcacggtgttgccgtaattttattaacgcgtttattcaaacatgcactgactctttctt |
36281689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 2797347 - 2797420
Alignment:
| Q |
174 |
tttggtggggttttgaggatgtgggaaggtgaactttttgattgctttgatcatcgtcgcattgctctagaatc |
247 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| || ||||||| || || |||||||| |||||||| ||||| |
|
|
| T |
2797347 |
tttggtggtgttttgaggatgtgggaaggtgaagttcttgattgtttcgagcatcgtcgaattgctcttgaatc |
2797420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University