View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9040_low_45 (Length: 299)
Name: NF9040_low_45
Description: NF9040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9040_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 35072076 - 35071797
Alignment:
| Q |
1 |
accacaccagttaactgattatccctaagttgcagatcttttatactattgcattgcgataaatctggaattggaccggtgaatttattcacatgaagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35072076 |
accacaccagttaactgattatccctaagttgcagatcttttatactattgcattgcgataaatctggaattggaccggtgaatttattcacatgaagcc |
35071977 |
T |
 |
| Q |
101 |
atacctgagttaacaatgtcatgttggaaatcacagtgattgaaccggttaacccaggtaaattgttattgatccaaaaactctgaattccggaaccagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35071976 |
atacctgagttaacaatgtcatgttggaaatcacagtgattgaaccggttaacccaggtaaattgttattgatccaaaaactctgaattccggaaccagc |
35071877 |
T |
 |
| Q |
201 |
gagagagttaggtaatcctccgctgagattgttgtatgcgagatgaagggtgttgagactagagaaactaccgaaaatgt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35071876 |
gagagagttaggtaatcctccgctgagattgttgtatgcgagatgaagggtgttgagactagagaaactaccgaaaatgt |
35071797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 10 - 77
Target Start/End: Complemental strand, 33920050 - 33919983
Alignment:
| Q |
10 |
gttaactgattatccctaagttgcagatcttttatactattgcattgcgataaatctggaattggacc |
77 |
Q |
| |
|
||||||||| ||||||||||||||||||| | |||| |||||||||||||||||||| |||| ||||| |
|
|
| T |
33920050 |
gttaactgactatccctaagttgcagatcatatatattattgcattgcgataaatctagaataggacc |
33919983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University