View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9040_low_56 (Length: 264)
Name: NF9040_low_56
Description: NF9040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9040_low_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 59 - 257
Target Start/End: Original strand, 2359735 - 2359933
Alignment:
| Q |
59 |
caacaacaaaagccacagttacgaagttcacaacttgttgcattggaatatgctgacctcaatctctcttacaacttggtttgtttctttatttatgtcc |
158 |
Q |
| |
|
||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2359735 |
caacaacaaaaaccacaactacgaagctcacaacttgttgcattggaatatgctgacctcaatctctcttacaacttggtttgtttctttatttatgtcc |
2359834 |
T |
|
| Q |
159 |
tttttacttacaaatggataataatataatcaatttctatatttcagaatttgggtcatggcagaattaggcaacatgtcaatccttcttctttctctg |
257 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2359835 |
tttttacttagaaatggataataatataatcaatttctatatttcagaatttgggtcatggcagaatcaggcaacatgtcaatccttcttctttctctg |
2359933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 86 - 138
Target Start/End: Original strand, 2351332 - 2351384
Alignment:
| Q |
86 |
tcacaacttgttgcattggaatatgctgacctcaatctctcttacaacttggt |
138 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||||| |||||| |||||||||| |
|
|
| T |
2351332 |
tcacaactcgttgcattagaatatgctgaactcaacctctctaacaacttggt |
2351384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 199 - 243
Target Start/End: Original strand, 2351462 - 2351506
Alignment:
| Q |
199 |
atttcagaatttgggtcatggcagaattaggcaacatgtcaatcc |
243 |
Q |
| |
|
||||||| || ||||||||| |||||| ||||||||||||||||| |
|
|
| T |
2351462 |
atttcaggatatgggtcatgtcagaatcaggcaacatgtcaatcc |
2351506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University