View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9040_low_69 (Length: 220)
Name: NF9040_low_69
Description: NF9040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9040_low_69 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 7e-45; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 17 - 120
Target Start/End: Complemental strand, 15081535 - 15081432
Alignment:
| Q |
17 |
ctataactatttgtgttgctttaaaagatatgtgataaataacttgagaagatatgttttaaatagtaaataccaattttattgacttcaaattgttctt |
116 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
15081535 |
ctataaccatttgtgttgctttaaaagatatgtgataaataacttgagaagatatgttttaaatagtaaataccaattttattgatttcaaattgtcctt |
15081436 |
T |
|
| Q |
117 |
gttg |
120 |
Q |
| |
|
|||| |
|
|
| T |
15081435 |
gttg |
15081432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 15081387 - 15081307
Alignment:
| Q |
140 |
tgaaggccaataacgagtcctctgtacttcggctggggttaagacagccctttgagcaccaacataaccatgtgagtacaa |
220 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15081387 |
tgaatgccaataacgagtcctctgtacttcggctggggttaagacagccctttgagcaccaacataaccatgtgagtacaa |
15081307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 111 - 150
Target Start/End: Original strand, 15078946 - 15078985
Alignment:
| Q |
111 |
gttcttgttgctgcaatatatggcagaaatgaaggccaat |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15078946 |
gttcttgttgctgcaatatatggcagaaatgaaggccaat |
15078985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University