View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9040_low_75 (Length: 202)

Name: NF9040_low_75
Description: NF9040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9040_low_75
NF9040_low_75
[»] chr8 (1 HSPs)
chr8 (1-190)||(29607516-29607705)


Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 29607516 - 29607705
Alignment:
1 ccattttgttatgtgtcacttgagtaactgcagaagatgctcatatgacaaaacatggattcgagcgaaacggttatttggtttgcaaaaatataaaatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
29607516 ccattttgttatgtgtcacttgagtaactgcagaagatgctcatatgacaaaacatggattcaagcgaaacggttatttggtttgcaaaaatataaaatt 29607615  T
101 atttcatatgtatggaattgaatgatgaacaattatactcataatatttttcttatccttttgttctttcattgtattgtggtctctgct 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
29607616 atttcatatgtatggaattgaatgatgaacaattatactcataatatttttcttatccttttgttctttcattgtattgtggtctttgct 29607705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University