View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9041_low_12 (Length: 406)
Name: NF9041_low_12
Description: NF9041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9041_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 132 - 393
Target Start/End: Complemental strand, 36281605 - 36281344
Alignment:
| Q |
132 |
gttaacaatcaaacatttgggtgttgcagttgtccttgctaccgatttgggaagaacatgaagagagctggttttggttcttgcttcattcaggtctata |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36281605 |
gttaacaatcaaacatttgggtgttgcagttgtccttgctaccgatttgggaagaacatgaagagagctggttttggttcttgcttcattcaggtctata |
36281506 |
T |
 |
| Q |
232 |
tttgagttcattgaaaattaattagtcaaagggtgtttatgctttgttaaaaatgattcaactactaatggatttggcaattttctatgttttaatttgt |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36281505 |
tttgagttcattgaaaattaattagtcaaagggtgtttatgctttgttaaaaatgattcaactactaatggatttggcaattttctatgttttaatttgt |
36281406 |
T |
 |
| Q |
332 |
cactttattttatatgactctgaaatttgaagcttctttgtcttattttgtaggcaacaatt |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36281405 |
cactttattttatatgactctgaaatttgaagtttctttgtcttattttgtaggcaacaatt |
36281344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 55
Target Start/End: Complemental strand, 36281712 - 36281680
Alignment:
| Q |
23 |
tcaaacatgcactgactctttcttttggaatat |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36281712 |
tcaaacatgcactgactctttcttttggaatat |
36281680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 155 - 226
Target Start/End: Original strand, 2798489 - 2798560
Alignment:
| Q |
155 |
ttgcagttgtccttgctaccgatttgggaagaacatgaagagagctggttttggttcttgcttcattcaggt |
226 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||| |||||||||||| |||||||| |
|
|
| T |
2798489 |
ttgcagttgtccctgctaccgatttgggaagaacatgaaacgagctggtcttggttcttgctatattcaggt |
2798560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 155 - 226
Target Start/End: Original strand, 18312914 - 18312985
Alignment:
| Q |
155 |
ttgcagttgtccttgctaccgatttgggaagaacatgaagagagctggttttggttcttgcttcattcaggt |
226 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| || ||||| |||||||||||| |||||||| |
|
|
| T |
18312914 |
ttgcagttgtctctgctaccgatttgggaagaacatgaagcgaactggtcttggttcttgctatattcaggt |
18312985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University