View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9042_low_9 (Length: 229)
Name: NF9042_low_9
Description: NF9042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9042_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 24 - 216
Target Start/End: Original strand, 36637308 - 36637500
Alignment:
| Q |
24 |
gactcccttgctctttgtgattaccatttccattagtagcaactgttggagatgaaggaaccttatcaatgatagatgaaagcggcgaatcaagttcctc |
123 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36637308 |
gactcccttgctcttcgtgattaccatttccattagtagcaaccgttggagatgaaggaaccttatcaatgatagatgaaagcggcgaatcaagttcctc |
36637407 |
T |
|
| Q |
124 |
aagttcttcatcgcttgtatatcctctccgctgaacggccgatacattcctcgtcaggtgacactttcctcccgcctctgcaactttctctgc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36637408 |
aagttcttcatcgcttgtatatcctctccgctgaacggccgatacattcctcgtcaggtgacactttcctcctgcctctgcaactttctctgc |
36637500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University