View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9043_high_7 (Length: 241)
Name: NF9043_high_7
Description: NF9043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9043_high_7 |
 | |
|
| [»] scaffold0069 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0069 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: scaffold0069
Description:
Target: scaffold0069; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 109 - 225
Target Start/End: Complemental strand, 1398 - 1282
Alignment:
| Q |
109 |
caattgtcttgcttgtttggattggcaattgctgatattcaatgtgaatttacaaaagctacaattacaaattgtaggatttgttaagggacttaacgta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1398 |
caattgtcttgcttgtttggattggcaattgctgatattcaatgtgaatttacaaaagctacaattacaaattgtaggatttgttaagggacttaacgta |
1299 |
T |
|
| Q |
209 |
gaatttttgtttgaaaa |
225 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1298 |
gaatttttgtttgaaaa |
1282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0069; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 50
Target Start/End: Complemental strand, 1500 - 1471
Alignment:
| Q |
21 |
cttttatgtctttgattgtctataagttat |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1500 |
cttttatgtctttgattgtctataagttat |
1471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 109 - 225
Target Start/End: Original strand, 42574304 - 42574420
Alignment:
| Q |
109 |
caattgtcttgcttgtttggattggcaattgctgatattcaatgtgaatttacaaaagctacaattacaaattgtaggatttgttaagggacttaacgta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42574304 |
caattgtcttgcttgtttggattggcaattgctgatattcaatgtgaatttacaaaagctacaattacaaattgtaggatttgtgaagggacttaacgta |
42574403 |
T |
|
| Q |
209 |
gaatttttgtttgaaaa |
225 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42574404 |
gaatttttgtttgaaaa |
42574420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 50
Target Start/End: Original strand, 42574202 - 42574231
Alignment:
| Q |
21 |
cttttatgtctttgattgtctataagttat |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42574202 |
cttttatgtctttgattgtctataagttat |
42574231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University