View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9043_low_18 (Length: 241)

Name: NF9043_low_18
Description: NF9043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9043_low_18
NF9043_low_18
[»] scaffold0069 (2 HSPs)
scaffold0069 (109-225)||(1282-1398)
scaffold0069 (21-50)||(1471-1500)
[»] chr8 (2 HSPs)
chr8 (109-225)||(42574304-42574420)
chr8 (21-50)||(42574202-42574231)


Alignment Details
Target: scaffold0069 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: scaffold0069
Description:

Target: scaffold0069; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 109 - 225
Target Start/End: Complemental strand, 1398 - 1282
Alignment:
109 caattgtcttgcttgtttggattggcaattgctgatattcaatgtgaatttacaaaagctacaattacaaattgtaggatttgttaagggacttaacgta 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1398 caattgtcttgcttgtttggattggcaattgctgatattcaatgtgaatttacaaaagctacaattacaaattgtaggatttgttaagggacttaacgta 1299  T
209 gaatttttgtttgaaaa 225  Q
    |||||||||||||||||    
1298 gaatttttgtttgaaaa 1282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0069; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 50
Target Start/End: Complemental strand, 1500 - 1471
Alignment:
21 cttttatgtctttgattgtctataagttat 50  Q
    ||||||||||||||||||||||||||||||    
1500 cttttatgtctttgattgtctataagttat 1471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 109 - 225
Target Start/End: Original strand, 42574304 - 42574420
Alignment:
109 caattgtcttgcttgtttggattggcaattgctgatattcaatgtgaatttacaaaagctacaattacaaattgtaggatttgttaagggacttaacgta 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
42574304 caattgtcttgcttgtttggattggcaattgctgatattcaatgtgaatttacaaaagctacaattacaaattgtaggatttgtgaagggacttaacgta 42574403  T
209 gaatttttgtttgaaaa 225  Q
    |||||||||||||||||    
42574404 gaatttttgtttgaaaa 42574420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 50
Target Start/End: Original strand, 42574202 - 42574231
Alignment:
21 cttttatgtctttgattgtctataagttat 50  Q
    ||||||||||||||||||||||||||||||    
42574202 cttttatgtctttgattgtctataagttat 42574231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University