View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9044_high_4 (Length: 217)
Name: NF9044_high_4
Description: NF9044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9044_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 207
Target Start/End: Original strand, 5230500 - 5230690
Alignment:
| Q |
17 |
atgcaatgttgctaatggaaaatggatatttaacagttcaataaagcctttatactcagataaaagctgtccatacatagataaacaattttcttgtgtc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5230500 |
atgcaatgttgctaatggaaaatggatatttaacagttcaataaagcctttatactcagataaaagctgtccatacatagataaacaattttcttgtgtc |
5230599 |
T |
 |
| Q |
117 |
aagaatggaaggaatgattctgattatcttcattgggagtggcagccagaagattgtaccttgccacagtaagttttcacacactctaact |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5230600 |
aagaatggaaggaatgattctgattatcttcattgggagtggcagccagaagattgtaccttgccacagtaagttttcacacactctaact |
5230690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 84 - 182
Target Start/End: Original strand, 25338328 - 25338426
Alignment:
| Q |
84 |
tgtccatacatagataaacaattttcttgtgtcaagaatggaaggaatgattctgattatcttcattgggagtggcagccagaagattgtaccttgcca |
182 |
Q |
| |
|
|||||||| ||||| | ||||||||||||| | || ||||| || | ||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25338328 |
tgtccatatatagaaagacaattttcttgtataaaaaatggtagaacagattctgattatcaacattgggagtggcagccagaagattgcaccttgcca |
25338426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University