View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9045_low_15 (Length: 309)
Name: NF9045_low_15
Description: NF9045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9045_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 299
Target Start/End: Complemental strand, 36969403 - 36969105
Alignment:
| Q |
1 |
cctaaccttaaaaccggggaccactatctcgtttttcattaatttgcataattaaccgtgaaaatccaatcaaatttcaggcatgcttcattctactaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36969403 |
cctaaccttaaaaccggggaccactatctcgtttttcattaatttgcataattaaccgtgaaaatccaatcaaatttcaggcatgcttcattctactaat |
36969304 |
T |
|
| Q |
101 |
ttgaaatgatgtattaggacatcatctcccattaaattaagttgacagcaaagtcattaactctcagtttgaaacttatgtcagaattagggtttcagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36969303 |
ttgaaatgatgtattaggacatcatctcccattaaattaagttgacagcaaagtcattaactctcagtttgaaacttatgtcagaattagggtttcagtt |
36969204 |
T |
|
| Q |
201 |
agcatttcctctctatattggaaatttgggaccacttctcaactatactatcgatttaattatgccttatatatactctcttatgttgtgtcctctctg |
299 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36969203 |
agcatttcctctctatattgggaatttgggaccacttctcaactatactatcgatttaattatgccttatatatactctcttatgttgtgtcctctctg |
36969105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University