View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9045_low_20 (Length: 223)
Name: NF9045_low_20
Description: NF9045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9045_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 15 - 204
Target Start/End: Original strand, 5709187 - 5709376
Alignment:
| Q |
15 |
tcgtgttcacagtcagtcatgatccatgatattgcagaaaagtcttctcattacagaaagtcctaattagatcgtgcctttatattatggtcgtggtcgg |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5709187 |
tcgtggtcacagtcagtcatgatccatgatattgcagaaaagtcttctcattacagaaagtcctaattagatcgtgcctttatattatggtcgtggtcgg |
5709286 |
T |
 |
| Q |
115 |
tcctgtttcatgatattgcagttaattgttgtcaaatagggcttacgatagcaatcccattgtggttgaagagacatcaaacacgataat |
204 |
Q |
| |
|
|| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5709287 |
tcgtgtttcatgatattgcagtgaattgttgtcaaatagggcttacgatagcaatcccattgtggttgaagagacatcaaacacgataat |
5709376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University