View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9046_low_16 (Length: 328)
Name: NF9046_low_16
Description: NF9046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9046_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 27922211 - 27922451
Alignment:
| Q |
17 |
agaacgaaacttttaagcacataaatgaaaacacgaaattgctagtgcaggagaggagaattcgcgcacttgactcaaatatttttnnnnnnnnnn---- |
112 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
27922211 |
agaacgaaacttttaagcacacaaatgaaagcacgaaattgctagtgcgcgagaggagaattcgcgcacttcactcaaatattaaaaaaaaaaaaaaaaa |
27922310 |
T |
 |
| Q |
113 |
ctagaatctctaaggtatttaacacatcttgagacttgttaatctattgataagtaattttaagacactcagggcaatactctacacttaaggtctgcct |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
27922311 |
ctagaatctctaagatatttaacacatcttgagacttgttaatctattgataagtaattttaagacactcagggaaatcctctacacttaaggtctgcct |
27922410 |
T |
 |
| Q |
213 |
aatcttcactaaaattataagctgcttatgctataaactca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27922411 |
aatcttcactaaaattataagctgcttatgctataaactca |
27922451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University