View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9047_high_2 (Length: 239)
Name: NF9047_high_2
Description: NF9047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9047_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 40063622 - 40063812
Alignment:
| Q |
1 |
ttgataaatggattataaagtggaccaaaacttgaaaatcactctaaat----accaacaatgacccatgtcatcttttaaaggtggaagctcattgtca |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40063622 |
ttgataaatggattataaagtggaccaaaacttgaaaatcactctaaattaataccaacaatgacccatgtcatcttttaaaggtggaagctcattgtca |
40063721 |
T |
 |
| Q |
97 |
tcccttttctcatgaatgagattgtgacttacatcaattcgaggacaacaaagg-aaattaatgagatgaatttttatacactcacattaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40063722 |
tcccttttctcatgaatgagattgtgacttacatcaattcgaggacaacaaaggaaaattaatgagatgagtttttatacactcacattaa |
40063812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University