View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9048_high_10 (Length: 215)
Name: NF9048_high_10
Description: NF9048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9048_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 23 - 199
Target Start/End: Complemental strand, 36723568 - 36723392
Alignment:
| Q |
23 |
cgttccacgcatgtaataaaaaatagtaagacatattagcacatgtttgcattttccatggttgacaagccactataaaagaaacacttcctaatactca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36723568 |
cgttccacgcatgtaataaaaaatagtaagacatattagcacatgtttgcattttccatggttgacaagccactataaaagaaacacttcctaatactca |
36723469 |
T |
|
| Q |
123 |
tagatctgtatgccttcagcacaaaatataatggcaacctcaattggttgcatatattactatcttttgttccttct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36723468 |
tagatctgtatgccttcagcacaaaatataatggcaacctcaattggttgcatatattactatcttttgttccttct |
36723392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University