View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9048_high_6 (Length: 342)
Name: NF9048_high_6
Description: NF9048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9048_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 20 - 326
Target Start/End: Original strand, 20368272 - 20368578
Alignment:
| Q |
20 |
gaagggagtgtgttacttgtggccctaacaagtcttttgaagatttttcagatatttacgctctcattatgaaaacttataactcatataatgttaattt |
119 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20368272 |
gaagggagtgtgttacttgtggcccaaacaagtcttttgaagatttttcagatatttacgccctcattatgaaaacttataactcatataatgttaattt |
20368371 |
T |
 |
| Q |
120 |
acgttttgatcatttgggattnnnnnnnctttgtgtcccttaatgtgctggaatcactcaaaggcttatcattctgtatatgatgatgatgcagaagaaa |
219 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20368372 |
acgttttgatcatttgggattaaaaaaactttgtgtcccttaatgtgttggaatcacttaaaggcttatcattatgtatatgatgatgatgcagaagaaa |
20368471 |
T |
 |
| Q |
220 |
atcaggatgatctatcgacggaaaatcaaagacactgattaaatttgctgggaatagatctggcttgaaggagccgatgcggctaggtgaacactttaag |
319 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20368472 |
atcaggatgatctatcgatggaaaatcaaagacactggttaaatttgatgggaccatatctggcttgaaggagccgatgcggctaggtgaacactttaag |
20368571 |
T |
 |
| Q |
320 |
atggaaa |
326 |
Q |
| |
|
||||||| |
|
|
| T |
20368572 |
atggaaa |
20368578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 255 - 326
Target Start/End: Complemental strand, 46951420 - 46951349
Alignment:
| Q |
255 |
tgattaaatttgctgggaatagatctggcttgaaggagccgatgcggctaggtgaacactttaagatggaaa |
326 |
Q |
| |
|
|||||||||||||||| | | ||| |||||| ||||| | |||||||| |||||||||||||||| ||||| |
|
|
| T |
46951420 |
tgattaaatttgctggtgacaaatcaggcttggaggaggccatgcggcttggtgaacactttaagaaggaaa |
46951349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 140
Target Start/End: Complemental strand, 46956131 - 46956050
Alignment:
| Q |
59 |
aagatttttcagatatttacgctctcattatgaaaacttataactcatataatgttaatttacgttttgatcatttgggatt |
140 |
Q |
| |
|
|||||||||||||||| | |||||||||||| | || | |||||| |||||| | |||||||| ||||||||||||||| |
|
|
| T |
46956131 |
aagatttttcagatatacatgctctcattatgcatacgttcaactcagataatgctgatttacgtgctgatcatttgggatt |
46956050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University