View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9048_high_9 (Length: 255)
Name: NF9048_high_9
Description: NF9048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9048_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 4 - 239
Target Start/End: Original strand, 52374965 - 52375200
Alignment:
| Q |
4 |
gagtttcgtgttctgaaggtgatttctgcctatgtgatgcaagatgatctcctctttccaatgctcacagttgaagaaactctcacctttgcagctgaat |
103 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52374965 |
gagtctcgtcttctgaaggtgatttctgcctatgtgatgcaagatgatctcctctttccaatgctcacagttgaagaaactctcacctttgcagctgaat |
52375064 |
T |
|
| Q |
104 |
tccgtttaccgcgatcactctcaaaatcaaagaaaaacgctcgtgttcaagctttgattgatcaactaggactccgcaacgcagcgaaaacagttatcgg |
203 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52375065 |
tccgattaccgcgatcactctcaaaatcaaagaaaaacgctcgtgttcaagctttgattgatcaactaggactccgcaacgcagcgaaaacagttatcgg |
52375164 |
T |
|
| Q |
204 |
agatgaaggtcaccgtggagtctctggtggagaaag |
239 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52375165 |
agacgaaggtcaccgtggagtctctggtggagaaag |
52375200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 34 - 237
Target Start/End: Complemental strand, 40384158 - 40383955
Alignment:
| Q |
34 |
tatgtgatgcaagatgatctcctctttccaatgctcacagttgaagaaactctcacctttgcagctgaattccgtttaccgcgatcactctcaaaatcaa |
133 |
Q |
| |
|
||||| |||||||| ||||| ||||| || |||||||| || ||||||||||||| || | ||||| || ||| | || || || ||||| ||||||| |
|
|
| T |
40384158 |
tatgtcatgcaagacgatcttctcttccccatgctcaccgtggaagaaactctcatgttctctgctgagtttcgtctccctcgctctctctccaaatcaa |
40384059 |
T |
|
| Q |
134 |
agaaaaacgctcgtgttcaagctttgattgatcaactaggactccgcaacgcagcgaaaacagttatcggagatgaaggtcaccgtggagtctctggtgg |
233 |
Q |
| |
|
||||||| |||||||| ||||| | || || || || || ||||||||||| || ||| || ||||||||||||||||||||||| || || ||||| |
|
|
| T |
40384058 |
agaaaaaagctcgtgtccaagcactcatcgaccagctcggtctccgcaacgctgcctcaactgtcatcggagatgaaggtcaccgtggtgtttccggtgg |
40383959 |
T |
|
| Q |
234 |
agaa |
237 |
Q |
| |
|
|||| |
|
|
| T |
40383958 |
agaa |
40383955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University