View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9048_low_20 (Length: 296)
Name: NF9048_low_20
Description: NF9048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9048_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 85 - 279
Target Start/End: Complemental strand, 30786315 - 30786121
Alignment:
| Q |
85 |
agattttactacatggatactataagattgacccttgcttggatcacacacaatagattgtcctttaattggtcaacaatgcatcaagttagagtctaag |
184 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30786315 |
agatattactacatggatactataagattgacccttgcttggatctcacacaatagattgtcctttaattggtcaacaatgcatcaagttagagtctaag |
30786216 |
T |
|
| Q |
185 |
agttgaaggatggcgaaaaaccaaacaacaaacatgttcgatgcattgttgcaacttcattgtttcatggtatactggcaatgtttctgtcacag |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30786215 |
agttgaaggatggcgaaaaaccaaacaacaaacatgttcgatgcattgttgcaacttcattgtttcatggtatactggcaatgtttctgtcacag |
30786121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 24 - 82
Target Start/End: Complemental strand, 30786399 - 30786341
Alignment:
| Q |
24 |
gcggtgaccccgtaatctttatattgcagttgtggatgcaatttaaaaccatgatgccc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30786399 |
gcggtgaccccgtaatctttatattgcagttgtggatgcaatttaaaaccatgatgccc |
30786341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University