View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9049_low_10 (Length: 339)
Name: NF9049_low_10
Description: NF9049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9049_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 9 - 165
Target Start/End: Original strand, 29487532 - 29487688
Alignment:
| Q |
9 |
gaagcagagagttgtggtggacgggacgatttatcggttgtcacgatgatactctttttctataatttagtttcgtgttcgcatgcagatgcgttgaatt |
108 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
29487532 |
gaagcagagagttgtggtggacgggtcgatttatcggttgtcacgatgatactctttttttataatttagtttcgtgttcgtatgttgatgcgttgaatt |
29487631 |
T |
 |
| Q |
109 |
gtgcacgtgatgtgtgattgttcgccttattttagatttgactctctactcttcaag |
165 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
29487632 |
gtgcacgtgacgtgtgattgttcgccttattttggatttgactctctacccttcaag |
29487688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 254 - 339
Target Start/End: Original strand, 29487777 - 29487862
Alignment:
| Q |
254 |
tatttgtttcttggttacaaaatttatggttgggattaaattttctaggaatatgatgatggaaatccttttgtaaatgaatgttt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29487777 |
tatttgtttcttggttacaaaatttatggtcgggattaaattttttaggaatatgatgatggaaatccttttgtaaatgaatgttt |
29487862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 325
Target Start/End: Original strand, 53925495 - 53925564
Alignment:
| Q |
256 |
tttgtttcttggttacaaaatttatggttgggattaaattttctaggaatatgatgatggaaatcctttt |
325 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| |||||||||| |||||| ||||||||| |
|
|
| T |
53925495 |
tttgtttcttggttacaaaatttatttccaggattaactttcctaggaatataatgatgcgaatcctttt |
53925564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University