View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9050_low_13 (Length: 274)
Name: NF9050_low_13
Description: NF9050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9050_low_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 234 - 274
Target Start/End: Original strand, 10664489 - 10664529
Alignment:
| Q |
234 |
gttggagtctaagttaatatccatattcattttttcctgat |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10664489 |
gttggagtctaagttaatatccatattcattttttcctgat |
10664529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University